En Defensa de los Derechos Fundamentales en Internet

Por Kirai el 02 de December de 2009 en Internet

Ante la inclusión en el Anteproyecto de Ley de Economía sostenible de modificaciones legislativas que afectan al libre ejercicio de las libertades de expresión, información y el derecho de acceso a la cultura a través de Internet, los periodistas, bloggers, usuarios, profesionales y creadores de Internet manifestamos nuestra firme oposición al proyecto, y declaramos que:

  • 1. Los derechos de autor no pueden situarse por encima de los derechos fundamentales de los ciudadanos, como el derecho a la privacidad, a la seguridad, a la presunción de inocencia, a la tutela judicial efectiva y a la libertad de expresión.
  • 2. La suspensión de derechos fundamentales es y debe seguir siendo competencia exclusiva del poder judicial. Ni un cierre sin sentencia. Este anteproyecto, en contra de lo establecido en el artículo 20.5 de la Constitución, pone en manos de un órgano no judicial -un organismo dependiente del ministerio de Cultura-, la potestad de impedir a los ciudadanos españoles el acceso a cualquier página web.
  • 3. La nueva legislación creará inseguridad jurídica en todo el sector tecnológico español, perjudicando uno de los pocos campos de desarrollo y futuro de nuestra economía, entorpeciendo la creación de empresas, introduciendo trabas a la libre competencia y ralentizando su proyección internacional.
  • 4. La nueva legislación propuesta amenaza a los nuevos creadores y entorpece la creación cultural. Con Internet y los sucesivos avances tecnológicos se ha democratizado extraordinariamente la creación y emisión de contenidos de todo tipo, que ya no provienen prevalentemente de las industrias culturales tradicionales, sino de multitud de fuentes diferentes.
  • 5. Los autores, como todos los trabajadores, tienen derecho a vivir de su trabajo con nuevas ideas creativas, modelos de negocio y actividades asociadas a sus creaciones. Intentar sostener con cambios legislativos a una industria obsoleta que no sabe adaptarse a este nuevo entorno no es ni justo ni realista. Si su modelo de negocio se basaba en el control de las copias de las obras y en Internet no es posible sin vulnerar derechos fundamentales, deberían buscar otro modelo.
  • 6. Consideramos que las industrias culturales necesitan para sobrevivir alternativas modernas, eficaces, creíbles y asequibles y que se adecuen a los nuevos usos sociales, en lugar de limitaciones tan desproporcionadas como ineficaces para el fin que dicen perseguir.
  • 7. Internet debe funcionar de forma libre y sin interferencias políticas auspiciadas por sectores que pretenden perpetuar obsoletos modelos de negocio e imposibilitar que el saber humano siga siendo libre.
  • 8. Exigimos que el Gobierno garantice por ley la neutralidad de la Red en España, ante cualquier presión que pueda producirse, como marco para el desarrollo de una economía sostenible y realista de cara al futuro.
  • 9. Proponemos una verdadera reforma del derecho de propiedad intelectual orientada a su fin: devolver a la sociedad el conocimiento, promover el dominio público y limitar los abusos de las entidades gestoras.
  • 10. En democracia las leyes y sus modificaciones deben aprobarse tras el oportuno debate público y habiendo consultado previamente a todas las partes implicadas. No es de recibo que se realicen cambios legislativos que afectan a derechos fundamentales en una ley no orgánica y que versa sobre otra materia.

Comentarios

  1. […] This post was mentioned on Twitter by Blogs_Japon, Iván Ortega Macías. Iván Ortega Macías said: http://www.kirainet.com/en-defensa-de-los-derechos-fundamentales-en-internet/ En defensa de los derechos fundamentales en internet […]

  2. Suscribo al 100%

  3. olé!

  4. Mas alto pero no mas claro.

  5. El problema es que el gobierno está totalmente perdido en matérias que desconoce y con Sinde…otra que pretende que sus amiguetes vivan toda la vida de rentas…
    Señores artistas, si quieren ganar pasta, a dar conciertos.
    Es curioso que todos los artistas que protestan son gente que ya no vende…y no es por el pirateo…es porque su música es una mierd… del pasado…

  6. […] Kirainet […]

  7. Gravatar de riddick75
    riddick75
    02 December, 2009

    España cada vez se parece más a la novela “1984”, y todo gracias al PSOE, que debería significar lo contrario al fascismo y al control total de sus ciudadanos (es decir libertad y progreso).
    No es de recibo que aprueben una ley orgánica, como bien dice el manifiesto, que regule algo que está regulado contitucionalmente, como el derecho a la intimidad o al secreto de las comunicaciones, o que igualmente se salte el derecho a la tutela judicial efectiva.
    Y lo que es más lamentable en el día de ayer los “artistas” estos se manifestaban en Madrid para apoyar tamaño recorte de los derechos fundamentales de los españoles, exponiendo para ello un manifiesto, manifiesto absurdo/egocéntrico/egoista que sólo firmaban poco más de 2000 personas, es decir por la opinión de 2000 individuos se van a tocar derechos fundamentales aprobados por votación de todos los españoles allá por 1978, es increible.
    Si las discográficas hubieran sido en su día propietarias de empresas de aceite de ballena a día de hoy seguiríamos alumbrándonos con candiles.

  8. totalmente de acuerdo, mi apoyo, saludos

  9. A mi lo de controlar internet con leyes me resulta un poco absurdo la verdad.

    Aqui no somos personas somos usuarios y la red no pertenece a un pais si no a un sistema global

  10. En vez de encontrar soluciones del siglo al que estamos buscan una forma de volver al pasado y seguir enriqueciéndose a costa del personal.

    La sociedad comete un supuesto crimen y por ello pagamos el canon por todos lados, se supone que si cumples la condena de algo es por que puedes hacer esa infracción, ¿no?

  11. Como los jueces no les echan cuenta, pues se han ido a pedirselo directamente a ZP recordandole el gesto de las cejas antes de las elecciones.

    Pero como TOD@S los operadores de internet en España saben para que se utilizan sus altas, como que no se dejaran fastidiar el negocio.

  12. Gravatar de ri0ArdilA
    ri0ArdilA
    02 December, 2009
  13. Totalemente de acuerdo. Me parece una vergüenza que estando en un estado democratico, se apoyen leyes que van en contra de la constitucion. Hay que denunciar esta ley al tribunal constitucional ya. Y sino que el rey haga algo que para eso esta, para defender la constitucion.

  14. Gravatar de kuanchankei
    kuanchankei
    02 December, 2009

    Con esos ministros y ministras paletas…. y esos artistas fracasados como Ramoncin…..¿qué se puede esperar de ellos?
    Pronto nos dirán a que hora conectarnos a internet, la dictadura silenciosa.

  15. Gravatar de Anonimous
    Anonimous
    02 December, 2009

    En general es una vergüenza ser español, se demuestra con cosas como esta, quien demonios vota a un partido político que no le conviene? solo el que se vasa en teorías y en nuestro caso quien usa el bipartidismo y vota al mismo perro con diferente collar.
    Aquí está la raíz de este problema y de muchos otros.

  16. […] Kirainet […]

  17. […] En Defensa de los Derechos Fundamentales en Internet […]

  18. Totalmente de acuerdo !!!
    Tanto les cuesta a esos funcionarios , que justamente viven de nosotros llegar a esta conclusión.
    Bravo…plas…plas…plas

  19. A mí, es que lo que me preocupa sinceramente es la torpeza como comunicadores de los que se abanderan como representantes de la cultura de España.

    Por ejemplo, reciente noticia (Madrid, 1 dic 2009 EFE): “La industria discográfica se manifiesta ante Industria contra la piratería”[1] (¡jas, con el titular podría ser una de cualquier momento del siglo XX y lo que llevamos de XXI!).

    “el ministro accedió a recibir a un grupo de representantes, formado por los artistas José María Sanz (“Loquillo”) y Luis Eduardo Aute, y por los presidentes de Sony Music, Carlos López, y de la asociación de Productores de Música de España (Promusicae), Antonio Guisasola.”

    Pero por el amor de Dios. ¡2009! ¿Quién ha tenido la brillante idea de poner como representantes del potencial creativo español amenazado por la vil internet a semejantes dinosaurios?

    Calla… me digo. Que como fans de Aute no soy, cierto es que no estoy muy puesto en su discografía más reciente, así que le consulto la Wikipedia (a la cual tengo acceso, por cierto, no gracias a la industrial cultural):

    “A día de hoy (2007), producido por Tony Carmona, es el primer disco de Aute con temas inéditos en cinco años[…]. En el 2009 ha colaborado con el rapero El Chojin en la segunda versión (remix) de la canción “Ríe cuando puedas, llora cuando lo necesites”

    Joder, vaya surtidor de cultura. Espera… me digo, a ver si es que hace otras cosas: productor, clases, jardinería. ¡Mira! Wikipedia me da el enlace a su página oficial… qué útil. En ella me encuentro con lo siguiente:

    “Wikipedia ofrece datos incompletos sobre la biografía del artista. Por favor, los interesados póngase en contacto con su agencia” y ya está.

    ¡Sí, señor! Eso es adaptarse a tiempos modernos. Creyéndome o no creeyéndome a wikipedia, como estoy yo para enviar un emilio a su agente Pérez para ver a qué se ha dedicado este hombre en los últimos años, que sabemos más de Bin Laden que de él y que levante la mano quien sepa dónde está el segundo.

    Rastrear la activdad de Loquillo la dejo para los demás, que yo ya sé que es un icono musical de lo más activo.

    Que es que de estar uno de acuerdo con esta gente, con semejantes representantes daría vergüenza suscribir nada. Si ponen el argumento en contra en bandeja, hombre.

    Los músicos de España que se sientan agregados a dicho comité necesitan pagarse una asesoría de relaciones públicas a la de ya.

    Por favor, interneteros, no os pirateéis a Aute, que como siga así nos vamos a quedar sin la música que no hace desde hace años.

    [1]: http://www.google.com/hostednews/epa/article/ALeqM5jObrlbrl-d5rL59o5Ds2yJifiHlQ

  20. […] | Kirainet, Microsiervos, El Blog de Enrique Dans, etc… Etiquetas: Derechos, Internet, Manifiesto […]

  21. el gobierno español siempre ha hecho lo que se le viene en gana y ahora con apoyo de empresas tiene mas poder, recuerdo que apenas unos pocos años, la gente tenia que pagarpor minuto cuando usaba internet gracias a timofonica, eso hizo que españa estuviera atrasado por decadas, hace 20 años era ilegal tener un modem telefonico, asi que espero que logren algo con su futil batalla, no olvidemos la SGAE que cobra a todos los CDs y DVDs por compensacion del precrimen jaja

  22. Gravatar de Jonteller
    Jonteller
    03 December, 2009

    Completamente de acuerdo

  23. Te copio y pego Hector.

    Gracias,

  24. […] Gracias a Kirainet.com […]

  25. Yo también me aputno a la iniciativa, como buen internauta, adicto al @ y al www, y seguidor de blogs.

    Por cierto, espero que la noticia que he visto sobre la Tarifa Plana sea una coña o un rumor que se quede en el olvido absuto. Porque si no.

  26. amen.
    jejeje como forma de protesta podrían organizar alguna campaña para dejar de comprar cd o dvd.
    Pd: que tiene que ver la economía sostenible con los cortes de internet sin orden judicial.

  27. […] Kirainet […]

  28. […] Desde Japón, Kirai se hace eco: En Defensa de los Derechos Fundamentales en Internet […]

  29. Bueno preparaos para que nos jodan las libertades… porque leyes para mejorar el trabajo, la sanidad, publica, las guarderias y demas no salen. Pero para estos mangantes en 3 dias ley lista y dispuesta.

    Y tanto peperos como sociatas la votaran en el congreso…

    ya lo decia una cancion:

    España el país de la patraña….

  30. Yo creo que todo dios nos iremos antes a vivir a Japón 😀 antes de ver como este país se va pudriendo.

  31. […] Kirai, Microsiervos, Menéame, Enrique […]

  32. Totalmente de acuerdo con el manifiesto. Ahora a difundir.

  33. apoyo

  34. Como fiel usuario de la internet desde windows 3.0, te doy mi apoyo, Kirai, a ti y a todos la comunidad de internet que lucha contra la imposicion de leyes en contra de la libertad de internet e informacion.

    Las grandes corporaciones deben adaptarse, no simplemente ir a llorarle a las leyes para que le pongan amarras a los que los “amenaza” indirectamente.

    Sepan si es que no se han dado cuenta, o se les olvido.
    El futuro de la raza humana es la LIBERTAD DE INFORMACION Y CONTENIDOS!, esto simplemente lo que hace es entorpecer todo el motor de avance de la gente que, VERDADERAMENTE mueve el mundo.

  35. Este gobierno no sabe distinguir entre poder judicial y poder ejecutivo, como tampoco sabe distinguir entre otras cosas.

    Querido Dios:

    Este año te llevaste a mi cantante favorito Michael Jackson, a mi actor preferido Patrick Swayze, a mi actriz favorita Farrah Fawcett y a mi escritor preferido Mario Benedetti.

    Quiero decirte que mi político preferido es José Luis Rodriguez Zapatero y que todavía no ha terminado el año…

  36. Voto a favor de la moción.

  37. Gravatar de leizerius
    leizerius
    04 December, 2009

    te apoyo totalmente, ya me fastidia tener q pagar el canon, para q paguen dinero a los incompetentes del cine español y a muchos musicos españoles (la mayoria) q no escucharia ni fumao, si todavia repartiesen el canon entre musicos japoneses, o para las peliculas y series norteamericanas lo pagaria encantado, pero me fastidia por la basura q se hace en nuestro pais.
    ademas, creo q el eliminar la piraeria perjudicara a los nuevos musicos, ya q sera mas dificil q se den a conocer e ira menos gente a sus conciertos.

  38. Gravatar de Viva la censura
    Viva la censura
    04 December, 2009

    La censura de estos fachas es intolerable. Ah no, que son los bueno buenisimos socialistas

  39. […] parece increíble lo que está pasando en España, estamos a un paso de perder muchos derechos fundamentales en Internet. Los entes carcas analógicos que gobiernan España están a punto de cargarse la libertad de […]

  40. […] parece increíble lo que está pasando en España, estamos a un paso de perder muchos derechos fundamentales en Internet. Los entes carcas analógicos que gobiernan España están a punto de cargarse la libertad de […]

  41. Mi más completo apollo y acuerdo con los 10 puntos de la Declaración por la Defensa de los Derechos Fundamentales en Internet.

    Parece que cada día estamos más cerca de un modelo de “democracia” al más puro estilo del Despotismo Ilustrado: “Todo para el pueblo pero sin el pueblo”.

  42. apollo ¿? …. ups! apoyo.
    sorry!

  43. Mira que criticar el PSOE el anterior proyecto de ley, que actualmente es legal por duro, cria PSOE y solo Dios sabe lo que votaras

  44. es increible mejor dicho guuuuuuuuaaaaaaauuuu

  45. hola a todos si teneis mesenller conectaos
    el viernes a las 5:12 vale

  46. falta algo falta algo berdad

  47. HOLA

    mcpaz,Nanaki,Albasan,riddick7,oscar,moichispa,lluna,Dandere,DaNi,Anonimous
    Wake_Up,elmimmo,fagg,Jonteller, Natsuno,
    2k,joaquin.

  48. A mí, es que lo que me preocupa sinceramente es la torpeza como comunicadores de los que se abanderan como representantes de la cultura de España.

    Por ejemplo, reciente noticia (Madrid, 1 dic 2009 EFE): “La industria discográfica se manifiesta ante Industria contra la piratería”[1] (¡jas, con el titular podría ser una de cualquier momento del siglo XX y lo que llevamos de XXI!).

    “el ministro accedió a recibir a un grupo de representantes, formado por los artistas José María Sanz (“Loquillo”) y Luis Eduardo Aute, y por los presidentes de Sony Music, Carlos López, y de la asociación de Productores de Música de España (Promusicae), Antonio Guisasola.”

    Pero por el amor de Dios. ¡2009! ¿Quién ha tenido la brillante idea de poner como representantes del potencial creativo español amenazado por la vil internet a semejantes dinosaurios?

    Calla… me digo. Que como fans de Aute no soy, cierto es que no estoy muy puesto en su discografía más reciente, así que le consulto la Wikipedia (a la cual tengo acceso, por cierto, no gracias a la industrial cultural):

    “A día de hoy (2007), producido por Tony Carmona, es el primer disco de Aute con temas inéditos en cinco años[…]. En el 2009 ha colaborado con el rapero El Chojin en la segunda versión (remix) de la canción “Ríe cuando puedas, llora cuando lo necesites”

    Joder, vaya surtidor de cultura. Espera… me digo, a ver si es que hace otras cosas: productor, clases, jardinería. ¡Mira! Wikipedia me da el enlace a su página oficial… qué útil. En ella me encuentro con lo siguiente:

    “Wikipedia ofrece datos incompletos sobre la biografía del artista. Por favor, los interesados póngase en contacto con su agencia” y ya está.

    ¡Sí, señor! Eso es adaptarse a tiempos modernos. Creyéndome o no creeyéndome a wikipedia, como estoy yo para enviar un emilio a su agente Pérez para ver a qué se ha dedicado este hombre en los últimos años, que sabemos más de Bin Laden que de él y que levante la mano quien sepa dónde está el segundo.

    Rastrear la activdad de Loquillo la dejo para los demás, que yo ya sé que es un icono musical de lo más activo.

    Que es que de estar uno de acuerdo con esta gente, con semejantes representantes daría vergüenza suscribir nada. Si ponen el argumento en contra en bandeja, hombre.

    Los músicos de España que se sientan agregados a dicho comité necesitan pagarse una asesoría de relaciones públicas a la de ya.

    Por favor, interneteros, no os pirateéis a Aute, que como siga así nos vamos a quedar sin la música que no hace desde hace años.

    [1]: http://www.google.com/hostednews/epa/article/ALeqM5jObrlbrl-d5rL59o5Ds2yJifiHlQ

  49. ME ESTOI HACIENDO CACA XDXDXDXDXDXDXDXDXD
    DXDXDXDXDXDXDXDXDDXDDDXDXDXDXDXDXDXDXD
    XDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDDXDXDXDXXXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDXDDXDXDXDDXDXDXDXDXDXDXDDXDDDXDX

  50. […] Kirainet […]



Lo más leído en Kirainet:

Fotografia

Fotografia